Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
CircRNA-012091 | |||
Gene | Organism | Rat | |
Genome Locus | Build | ||
Disease | Silicosis | ICD-10 | Pneumoconiosis due to other dust containing silica (J62.8) |
DBLink | Link to database | PMID | 30908929 |
Experimental Method | |||
Sample Type | Cell lines | Comparison | Mouse pulmonary fibroblasts (L929) and human pulmonary fibroblasts from adults (HPF-a) |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TACCTGGAGAAAAGCGCACTG ReverseCTCGACAGGTGGTTTCTGGTG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Cheng, Y, Luo, W, Li, Z, Cao, M, Zhu, Z, Han, C, Dai, X, Zhang, W, Wang, J, Yao, H, Chao, J (2019). CircRNA-012091/PPP1R13B-mediated Lung Fibrotic Response in Silicosis via Endoplasmic Reticulum Stress and Autophagy. Am. J. Respir. Cell Mol. Biol., 61, 3:380-391. |